Review





Similar Products

97
Thermo Fisher gene exp pdk4 mm00443325 m1
Gene Exp Pdk4 Mm00443325 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/Gene+Exp%2E+Pdk4%2C+Mm00443325_m1/pmc13096911-240-63-19
Average 97 stars, based on 1 article reviews
gene exp pdk4 mm00443325 m1 - by Bioz Stars, 2026-10
97/100 stars
  Buy from Supplier

86
Sangon Biotech caagtctcagcaaaaggaacgt sangon biotech n a primer pdk4 promoter reverse
Caagtctcagcaaaaggaacgt Sangon Biotech N A Primer Pdk4 Promoter Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-58-59
Average 86 stars, based on 1 article reviews
caagtctcagcaaaaggaacgt sangon biotech n a primer pdk4 promoter reverse - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Sangon Biotech gacccagtcaccaatcaaaatct sangon biotech n a primer pdk4 reverse
Gacccagtcaccaatcaaaatct Sangon Biotech N A Primer Pdk4 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-171-172
Average 86 stars, based on 1 article reviews
gacccagtcaccaatcaaaatct sangon biotech n a primer pdk4 reverse - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Sangon Biotech caactgtcgctctcattgagt sangon biotech n a primer pdk4 forward
Caactgtcgctctcattgagt Sangon Biotech N A Primer Pdk4 Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-164-165
Average 86 stars, based on 1 article reviews
caactgtcgctctcattgagt sangon biotech n a primer pdk4 forward - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Sangon Biotech caggtcttggataactttcta sangon biotech n a shrna pdk4
Caggtcttggataactttcta Sangon Biotech N A Shrna Pdk4, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-663-65-66
Average 86 stars, based on 1 article reviews
caggtcttggataactttcta sangon biotech n a shrna pdk4 - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

95
Proteintech pdk4
Pdk4, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/PDK4+Antibody/pm41922343-323-63-65
Average 95 stars, based on 1 article reviews
pdk4 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp pdk4 rn00585577 m1
A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( <t>Pdk4,</t> Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Gene Exp Pdk4 Rn00585577 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/Gene+Exp%2E+Pdk4%2C+Rn00585577_m1/bio_rxiv__64898__2026__03__16__710895-79-59-15
Average 86 stars, based on 1 article reviews
gene exp pdk4 rn00585577 m1 - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

98
Thermo Fisher gene exp pdk4 hs01037712 m1
A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( <t>Pdk4,</t> Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Gene Exp Pdk4 Hs01037712 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/Gene+Exp%2E+PDK4%2C+Hs01037712_m1/bio_rxiv__64898__2026__03__16__710895-79-57-15
Average 98 stars, based on 1 article reviews
gene exp pdk4 hs01037712 m1 - by Bioz Stars, 2026-10
98/100 stars
  Buy from Supplier

94
Novus Biologicals 07049 pdht
A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( <t>Pdk4,</t> Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
07049 Pdht, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdk4/PDK4+Antibody+-+BSA+Free/pm41812280-167-40-38
Average 94 stars, based on 1 article reviews
07049 pdht - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

Image Search Results


A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Western Blot, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, RNA Extraction, Isolation, Activity Assay, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, Marker

Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Staining, Western Blot, Marker

Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Expressing

A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Western Blot, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose for 24 hours and vehicle or 10 nM Everolimus treatment for 6 or 24 hours. A-D. The cardiomyocytes were subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein, total PDH, or total P70S6K, as indicated, and plotted. n=12,12,12 (REDD1), n=12,12,12,12,12,12 (pP70S6K (T389) and pPDH (S300)), 1-way ANOVA, 2-way ANOVA. E. The cardiomyocytes were subjected to total RNA extraction and qPCR for PDK4 . n=6,6,6,6,6,6, 2-way ANOVA. F. The cardiomyocytes were subjected to mitochondrial isolation, and PDH activity was measured. n=4,4, 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, RNA Extraction, Isolation, Activity Assay, Marker

AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: AC16 and AC16Δ REDD1 cardiomyocytes were cultured in DMEM, no glucose supplemented with 5.5 mM glucose and vehicle or 0.1 µM GW6471 treatment for 24 hours. A-B. Total RNA was extracted and qPCR was performed for the indicated genes. n=9,9,9 ( PDK4 ), n=9,9,6 ( ACSL1 ), 2-way ANOVA. C-E. Cardiomyocytes were harvested and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total protein or PDH as indicated, and plotted. n=9,9,6 (pPDH (S300)), n=7,9,8 (ACSL1), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Cell Culture, Western Blot, Marker

Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Adult (10-12-week-old) male and female mice of the indicated genotypes were subjected to 2 weeks TAC or Sham operation. Hearts were then harvested. A. Total RNA extraction and qPCR for Redd1 was performed (n=11,17), unpaired t test. B-C. Heart weights (HW) were normalized to (B) body weight (BW) or (C) tibia length (TL) and plotted as a ratio (mg/g or mg/mm, respectively). n=11,11,21,19 (HW/BW), n=11,11,21,19 (HW/TL), 2-way ANOVA. D-E. Hearts were fixed and stained with 594 wheat germ agglutinin. (D) Representative images are shown with 25 µm scale bars and (E) cardiomyocyte average cross-sectional area was measured. n=6,6,6,6, 2-way ANOVA. F&I. Total RNA extraction and qPCR for Nppb and Pdk4 were performed. n=27,17,20,18 ( Nppb ), n=23,25,16,19 ( Pdk4 ), 2-way ANOVA. G-H&J-K. Hearts were lysed and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to (H) total protein or (J-K) total PDH, and plotted. n=4,3,11,8 (CARP), n=9,8,11,8 (pPDH (S293)), n=9,8,12,8 (pPDH (S300)), 2-way ANOVA. Error bars represent SEM. *p<0.05, **p<0.01, ****p<0.0001. M = marker.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: RNA Extraction, Staining, Western Blot, Marker

Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Journal: bioRxiv

Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth

doi: 10.64898/2026.03.16.710895

Figure Lengend Snippet: Our findings outline a mechanism whereby pressure overload- or glucose-induced REDD1 is critical for activating glucose and suppressing fatty acid oxidation pathways. Specifically, elevated REDD1 inhibits PPARα, thus inhibiting the expression of PDK4 and fatty acid catabolic genes. We also show that this is independent of REDD1’s ability to inhibit mTORC1.

Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using TaqMan Gene Expression Assays (ThermoFisher Scientific) and the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for the following genes: 18S (Mm03928990_g1), Redd1 (Mm00512504_g1), PDK1 (Hs05380290_s1), Pdk1 (Rn00587598_m1), PDK2 (Hs04965351_m1), Pdk2 (Rn00446679_m1), PDK3 (Hs03878443_s1), Pdk3 (Rn01424337_m1), PDK4 (Hs01037712_m1), Pdk4 (Rn00585577_m1), PDP1 (Hs01081518_s1), Pdp1 (Rn01437077_m1), PDP2 (Hs01934174_s1), Pdp2 (Mm02526496_s1), ACSL1 (Hs00960561_m1), or Nppb (Mm01255770_g1).

Techniques: Expressing